Ever need a fact or quotation on trophoblast? Designed for speechwriters, journalists, writers, researchers, students, professors, teachers, historians, academics, scrapbookers, trivia buffs and word lovers, this is the largest book ever created for this single word. It represents a compilation from a variety of sources with a linguistic emphasis on anything relating to the term “trophoblast,” including non-conventional usage and alternative meanings which capture ambiguities. The entries cover all parts of speech (noun, verb, adverb or adjective usage) as well as use in modern slang, pop culture, social sciences (linguistics, history, geography, economics, sociology, political science), business, computer science, literature, law, medicine, psychology, mathematics, chemistry, physics, biology and other physical sciences. This “data dump” results in many unexpected examples for trophoblast, since the editorial decision to include or exclude terms is purely a linguistic process. The resulting entries are used under license or with permission, used under “fair use” conditions, used in agreement with the original authors, or are in the public domain. Proceeds from this book are used to expand the content and coverage of Webster’s Online Dictionary (www.websters-online-dictionary.org).

Nonfiction Usage

Patent Usage

5T4 antigen from human trophoblasts: Patented by Peter Stern and Nicholas Hole on August 7, 1993. Abstract: A new glycoprotein 5T4 has been identified in human trophoblast. The antigen and fragments thereof and, more particularly, antibodies that recognise the antigen or fragments thereof are of value in relation to cancer diagnosis and treatment, particularly for the routine screening of cervical smears.

Cytotrophoblast antigen and monoclonal antibodies which specifically bind cytotrophoblast cells: Patented by Simon C. Shorter, Bernadette L. Ferry, Phyllis M. Starkey, Ian L. Sargent and Christopher W. Redman on February 3, 1995. Abstract: A monoclonal antibody specific for a unique subset of extra-villous trophoblast in human placental tissue, the cell line that produces it, and the isolated antigen to which it is directed.

Enrichment and Identification of Trophoblast Cells in Maternal Peripheral Blood: Patented by Bill Kalionis on September 18, 1998. Abstract: A method for separation of trophoblast cells from a sample of peripheral blood of a pregnant mammal, particularly a pregnant human, comprises passing the peripheral blood sample through a selective filter to separate a fraction comprising trophoblast cells present in the peripheral blood sample.

Human Trophoblast and Choriocarcinoma Inhibition: Patented by Anton Wellstein, Anke Schulte, Shoupeng Lai, Andreas Kurtz, Frank Czubayko and Anna Riegel on December 2, 1997. Abstract: It was found that the depletion of HERV–PTN mRNA prevents human choriocarcinoma growth, invasion and angiogenesis. Growth, invasion and angiogenesis of a tumor containing human endogenous retrovirus–pleiotrophin (HERV–PTN) sequences may be inhibited by administration of a choriocarcinoma inhibiting amount of PTN–targeted ribozymes. A ribozyme of the formula: '5–GTTGCAGGGCTGATGAGTCCGTTAGGACGAAATCTTACATC–3' was found to be particularly useful for this purpose.

Hyperglycosylated Hcg (invasive Trophoblast Antigen) in Differential Diagnosis of Malignant or Invasive Trophoblastic Disease: Patented by Laurence A. Cole on July 9, 2003. Abstract: The invention provides methods for detecting the presence or absence of invasive trophoblast cells. In addition, the invention provides methods for distinguishing quiescent trophoblast diseases from invasive trophoblast diseases and methods for monitoring progression of quiescent trophoblast diseases. The invention provides methods for detecting the presence or absence of germ cell tumors.

Immunological Binding Molecules Inhibiting the Syncytial Fusion of Trophoblast Cells: Patented by Hans-Georg Frank, Peter Kaufmann and Ulrike Schmitz on July 3, 2002. Abstract: The invention relates to a protein which inhibits a syncytial fusion, and of which at least 80 % is homologous with the V1 or Vh protein of the chicken. The invention also relates to fragments having at least 12 connecting amino acids from the sequence of the V1 or Vh protein of the chicken.

Interferon proteins: Patented by Peter Ebbesen, George Aboagye-Mathiesen and Ferenc D. Toth on December 6, 1991. Abstract: The invention relates to a method for producing isolating and purifying trophoblast interferon proteins such as .beta.-interferons, .alpha.sub.I -interferon proteins, .alpha.sub.II -interferon proteins, and .gamma.-interferon proteins, and to a method of using the interferon proteins, e.g. for inhibiting tumoral growth or metastatic processes, for preventing graft-versus-host reaction, against leukemia, against viral activity, and against infection of the placenta; as well as antibodies against the interferon proteins.

Method for Generating Primate Trophoblasts: Patented by Ren-He Xu and James A. Thomson on March 14, 2003. Abstract: The first method to cause a culture of human and other primate stem cells to directly and uniformly differentiate into a committed cell lineage is disclosed. Treatment of primate stem cells with a single protein trophoblast induction factor causes the cells to transform into human trophoblast cells, the precursor cells of the placenta. Several protein factors including bone morphogenic protein 4 (BMP4), BMP2, BMP7, and growth and differentiation factor 5 can serve as trophoblast-inducting factors.

Methods and Kits for Detecting Ita in a Biological Sample: Patented by Murugan R. Pandian and Julie Y. Lu on July 30, 2002. Abstract: Methods for detecting invasive trophoblast antigen (ITA) in biological samples comprise screening the samples for ITA using antibodies that bind to the ITA. The methods are useful to detect pregnancy, trophoblastic diseases, and Down's syndrome in fetuses of pregnant women. Some methods include screening the samples with a plurality of capture antibodies that specifically bind ITA. Chemiluminescent immunoassays are disclosed. The methods may be practiced with the diagnostic kits of the invention.

Methods for Detecting Down's Syndrome: Patented by Murugan R. Pandian and Julie Y. Lu on July 30, 2002. Abstract: Methods for detecting Down's syndrome in a fetus of a pregnant woman include screening serum samples obtained from the pregnant woman for abnormal levels of invasive trophoblast antigen. In particular, serum levels of invasive trophoblast antigen are compared to a standard. The methods can also be practiced using at least one additional marker.

• Preface iv
• Nonfiction Usage 1
• Patent Usage 1
• Bibliographic Usage 3
• Lexicographic Usage 96
• Index 102